Journal: The Journal of Biological Chemistry

Article Title: Loss of the tumor suppressor BIN1 enables ATM Ser/Thr kinase activation by the nuclear protein E2F1 and renders cancer cells resistant to cisplatin

doi: 10.1074/jbc.RA118.005699

Figure Lengend Snippet: E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) plasmid DNA linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.

Article Snippet: The human BIN1 sh-RNA–expressing lentivirus plasmid DNA (sc-29804-SH, Santa Cruz Biotechnology) was cotransfected in the HEK293T cells (a packaging cell line) with the psPAX2 plasmid DNA (a lentivirus packaging vector) (Addgene, Cambridge, MA) and the pMD2.G plasmid DNA (a lentivirus VSV-G envelope–expressing vector) (Addgene).

Techniques: Co-Immunoprecipitation Assay, Western Blot, Luciferase, Activity Assay, In Vivo, Binding Assay, Transfection, Plasmid Preparation, Negative Control, Amplification, Immunoprecipitation, Stable Transfection

Journal: Cell

Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma

doi: 10.1016/j.cell.2020.03.062

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat# G0345 psPAX2 Addgene Cat# 12259 pCMV-VSV-G Addgene Cat# 8454 Software and Algorithms ImageJ NIH N/A QuPath v0.1.2 Github N/A Prism v8.0 Graphpad N/A Image Studio Lite LI-COR N/A PHATE https://github.com/KrishnaswamyLab/PHATE N/A MAGIC https://github.com/KrishnaswamyLab/MAGIC N/A FASTX-toolkit Greg Hannon lab ( http://hannonlab.cshl.edu/fastx_toolkit ) N/A Burrows-Wheeler Aligner v0.5.5 Source Forge N/A Picard toolkit v1.21 Github N/A GATK v.1.0.5538 Broad Institute N/A ANNOVAR http://annovar.openbioinformatics.org/ N/A RSEM v.1.2.12 Dewey lab/Github N/A Cytoscape v.3.3.0 Cytoscape Consortium N/A Cell Ranger 10X Genomics N/A SAS v9.4 SAS Institute, Inc. N/A MELD https://github.com/KrishnaswamyLab/MELD N/A diffxpy https://github.com/theislab/diffxpy/ N/A R package JADE https://www.rdocumentation.org/packages/JADE/versions/1.1-0 N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: Analysis of LNS-associated HPRT1 variants that are targetable by BEs and PEs (A) Classification of mutation types of HPRT1 variants derived from the LNS-associated genetic variants database ( http://www.lesch-nyhan.org/ ). (B) The proportion of HPRT1 variants that are targetable by CRISPR-mediated CBEs, ABEs, and PEs.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Mutagenesis, Derivative Assay, CRISPR

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: Introduction and correction of patient-derived HPRT1 mutations using CBEs and ABEs (A) Schematic overview of BE-meditated disease modeling and gene correction in human cells. (B) Target sequences of CBEs and ABEs for LNS-associated HPRT1 variants, c.430C>T (p.Q144∗) and c.508C>T (p.R170∗). The spacer sequences are indicated by boxes, and the target C:G pairs of CBEs and A:T pairs of ABEs are shown in blue and red, respectively. PAM sequences of each target site are shown in bold. (C) Heatmaps of CBE-mediated base editing frequencies for disease modeling of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as means from two biologically independent samples. (D) Heatmaps of ABE-meditated base editing frequencies for correction of c.430C>T (top panel) and c.508C>T (bottom panel) in HEK293T/17 cells. Data are shown as the mean of three biologically independent samples. (E) Sanger sequencing results of endogenous c.430C>T (p.Q144∗) and c.508C>T (p.R170∗) target sites in mutated and corrected HAP1 cells. The red boxes indicate nucleotides converted by CBEs and ABEs. (F) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (G) Crystal violet staining of mutated and corrected HAP1 cells selected in media containing 6-TG or HAT. (H) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Derivative Assay, Sequencing, Western Blot, Expressing, Staining, Activity Assay

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: Introduction and correction of patient-derived HPRT1 mutation using PE (A) Schematic overview of PE-mediated disease modeling and gene correction in human cells. The patient-derived HPRT1 mutation, c.333_334ins(A), is representatively described. (B) Target sequences of PEs for the LNS-associated HPRT1 mutation, c.333_334ins(A) (p.G112Rfs∗10). The representative spacer-#1 sequence and PAM sequence are indicated in box and bold, respectively. The inserted adenine is highlighted in red. (C) Prime editing frequencies for introducing c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (D) Prime editing frequencies of PE2, PE3, and PE3b to induce c.333_334ins(A) mutation. (E) Prime editing frequencies for correcting c.333_334ins(A) with pegRNAs containing variable lengths of PBS and RTT. The red arrow indicates the pegRNA used in subsequent experiments. (F) Prime editing frequencies with PE2 and PE3b to correct c.333_334ins(A) mutation. (G) Sanger sequencing results of endogenous c.333_334ins(A) (p.G112Rfs∗10) target sites in mutated and corrected HAP1 cells. The red arrow indicates the adenine inserted for disease modeling and gene correction by PEs. (H) Western blotting analysis of HPRT protein expression in mutated and corrected HAP1 cells. GAPDH was used as an internal control. (I) Crystal violet staining of PE-mediated mutated and corrected HAP1 cells selected with media containing 6-TG or HAT. (J) Results of IMP assay for HPRT activity in mutated and corrected HAP1 cells. Data are means from two or three biologically independent samples, and error bars indicate the standard error of the mean.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Derivative Assay, Mutagenesis, Sequencing, Western Blot, Expressing, Staining, Activity Assay

Journal: Molecular Therapy. Nucleic Acids

Article Title: Therapeutic gene correction for Lesch-Nyhan syndrome using CRISPR-mediated base and prime editing

doi: 10.1016/j.omtn.2023.02.009

Figure Lengend Snippet: PE-mediated gene correction of c.333_334ins(A) mutations in patient-derived fibroblasts (A) Renal ultrasound results of a patient with LNS with HPRT1 c.333_334ins(A) mutation. (B) Family pedigree of the patient with LNS with HPRT1 c.333_334ins(A) mutation. Fibroblasts were obtained from the patient with LNS as indicated with the red arrow. (C) Sequencing analysis of patient-derived fibroblasts to confirm the HPRT1 c.333_334ins(A) mutation. (D) Prime editing frequencies of various types of improved PEs and pegRNAs (top) for correcting the HPRT1 c.333_334ins(A) mutation. The red arrow indicates the pegRNA used in the subsequent experiment. Representative results of high-throughput sequencing of patient-derived fibroblasts treated with PE5max and tevopreQ pegRNA to correct the HPRT1 c.333_334ins(A) mutation (bottom) are shown. (E) Crystal violet staining of PE-mediated corrected fibroblasts with media containing 6-TG or HAT. Data are means from two biologically independent samples, and error bars indicate the standard error of the mean. (F) Western blotting analysis of HPRT protein expression in patient-derived fibroblast cells and HPRT1 c.333_334ins(A)-corrected patient-derived fibroblasts selected with HAT medium. GAPDH was used as an internal control.

Article Snippet: Briefly, 2 × 10 5 HEK293T/17 cells were seeded onto 24-well plates and transfected with 1 μg plasmid DNA (500 ng viral vector-containing HPRT1 mutant sequences, 300 ng psPAX2, and 200 ng pMD2.G) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instruction.

Techniques: Derivative Assay, Mutagenesis, Sequencing, Next-Generation Sequencing, Staining, Western Blot, Expressing